View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_212 (Length: 202)
Name: NF0809_low_212
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_212 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 75 - 193
Target Start/End: Complemental strand, 25002885 - 25002767
Alignment:
| Q |
75 |
ggaacaacgttatccaaattctgttgtggtggagaagagggagaagaagttggtgagagttgagagagatctaataagttgatttgattttgcagtttcc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25002885 |
ggaacaacgttatccaaattctgttgtggtggagaagagggagaagaagttggtgagagttgagagagatctaataagttgatttgattttgcagtttcc |
25002786 |
T |
|
| Q |
175 |
tgctggctttgatattctt |
193 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
25002785 |
tgctggctttgattttctt |
25002767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 138 - 193
Target Start/End: Original strand, 24998736 - 24998791
Alignment:
| Q |
138 |
gagagatctaataagttgatttgattttgcagtttcctgctggctttgatattctt |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
24998736 |
gagagttctaataagttgatttgattttgcagcttcctgttggctttgattttctt |
24998791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5911 times since January 2019
Visitors: 5761