View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_46 (Length: 468)
Name: NF0809_low_46
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 409 - 460
Target Start/End: Original strand, 11378678 - 11378729
Alignment:
| Q |
409 |
atcatagatactgtgatgtgaacatgtcaatgaaaaacatactccctttggt |
460 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11378678 |
atcataggtactgtgatgtgaacatgtcaatgaaaaacatactccctttggt |
11378729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 449
Target Start/End: Complemental strand, 2580417 - 2580348
Alignment:
| Q |
380 |
cttttcaccgtgtctgccacaaatggtagatcatagatactgtgatgtgaacatgtcaatgaaaaacata |
449 |
Q |
| |
|
||||||||||||| || |||||| |||||||||| ||||||||| |||| |||||||| | ||||||| |
|
|
| T |
2580417 |
cttttcaccgtgtgtgttgcaaatgatagatcataggtactgtgatatgaatatgtcaattagaaacata |
2580348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5512 times since January 2019
Visitors: 5757