View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_50 (Length: 462)
Name: NF0809_low_50
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 6e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 20596372 - 20596274
Alignment:
| Q |
30 |
tatcctcctcaattgccatgttttctcacctggtatttttacacagtgcatctgactctcacatgaacccttcttcccacgataaattaccttcaccct |
128 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20596372 |
tatcctcctcaattgccatgtttcctcacctggtatttttacacagtgcatctgactctcacatgaacccttcttcccacgacaaattaccttcaccct |
20596274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 79; Significance: 9e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 8697373 - 8697275
Alignment:
| Q |
30 |
tatcctcctcaattgccatgttttctcacctggtatttttacacagtgcatctgactctcacatgaacccttcttcccacgataaattaccttcaccct |
128 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8697373 |
tatcctcctcaattgccatgtttcctcatctggtatttttacacagtgcatttgactctcacatgaacccttcttcccacgacatattaccttcaccct |
8697275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 410 - 452
Target Start/End: Original strand, 24879513 - 24879555
Alignment:
| Q |
410 |
aagatttggaaatctcatgtacttattccatactctgtctctg |
452 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
24879513 |
aagatttggaaatctcaggtactcattccatactctgtctctg |
24879555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 408 - 452
Target Start/End: Original strand, 17403898 - 17403942
Alignment:
| Q |
408 |
ccaagatttggaaatctcatgtacttattccatactctgtctctg |
452 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
17403898 |
ccaagatttagaaatctcaggtactcattccatactctgtctctg |
17403942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4937 times since January 2019
Visitors: 5753