View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_64 (Length: 425)
Name: NF0809_low_64
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 80 - 279
Target Start/End: Complemental strand, 38943952 - 38943753
Alignment:
| Q |
80 |
gagatgaaccacatgttaataaattttcaaatgtcgaaatttacatatatgtttaatgtctagggggtcattgatgttactgctataagggtgcaatgct |
179 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38943952 |
gagaagaaccacatgttaataaattttcaaatgtcgaaatttacatatatgtttaatgtctagggggtcattgatgttactgctataagggtgcaatgct |
38943853 |
T |
|
| Q |
180 |
tctattgaagttgccacctgatagttatttttcatgcgtaatgtagttgtgtggcagcaactatttggtggaggaatcattgaaggaaaaccattaaatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38943852 |
tctattgaagttgccacctgatagttatttttcatgcgtaatgtagttgtgtggcagcaactatttggtggaggaatcattgaaggaaaacccttaaatt |
38943753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5885 times since January 2019
Visitors: 5761