View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_74 (Length: 403)
Name: NF0809_low_74
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 27 - 387
Target Start/End: Original strand, 6527990 - 6528350
Alignment:
Q |
27 |
catatttattattcttagacacatatctggctattctatagtgtaagcacaactattggtttgtaagtattcatttttggtgaaattgtctactcaccaa |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6527990 |
catatttattattcttagacacatatctggctattctatagtgtaagcacaactattggtttgtaagtattcatttttggtgaaattgtctactcaccaa |
6528089 |
T |
 |
Q |
127 |
tccatattacaatgcatattctaccgtcaaataacaaaaaccccttcccactaggaaggccttccaaacttgaaggacttatacttacctctttttacca |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6528090 |
tccatattacaatgcatattctaccgtcaaataacaaaaacccattcccactaggaaggccttccaaacttgaaggacttatacttacctctttttaccc |
6528189 |
T |
 |
Q |
227 |
tttaactttggttaaaactttttagattctaaaaagttgcatgagccatgacttagttcatttttgagttgaaattgcgaatatggtaatggaatctttc |
326 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
6528190 |
tttaactttggttaaaactttttagattctaaaaagttgcatgagccatgacttagttcattttttagttgaaattgcgaatatggtaatggaatctttc |
6528289 |
T |
 |
Q |
327 |
cttgatgcttggctagctcttcattagttctttccatttatattattttttaatcttccca |
387 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6528290 |
cttgatgcttggctagctcttcattagttctttccatttatattattttttaatcttccca |
6528350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4625 times since January 2019
Visitors: 5751