View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_87 (Length: 375)
Name: NF0809_low_87
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 50649254 - 50648909
Alignment:
Q |
1 |
tctgatgtttacctacttatgttgattttgatttgtatttgtatttctttgtagatgtcaactcttacaatcagttatgccaactagcaaatggtgaatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50649254 |
tctgatgtttacctacttatgttgattttgatttgtatttgtatttctttgtagatgtcaactcttacaatcagttatgccaactagcaaatggtgaatt |
50649155 |
T |
 |
Q |
101 |
cagaagtctgtttctttagggagcttgaagattgttggattagctagtggatggtattgagttgcagcctttatgctaaagaacgtcttacnnnnnnnnn |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50649154 |
cagaagtctgtttctttagggagcttgaagattgttggattagctagtggatggtattgagttgcagcctttatgctaaagaacgtcttacttttttaca |
50649055 |
T |
 |
Q |
201 |
nnnnnnattggaactatatatataatgtatatgtttattacctgaggaatcgatatgtagacatatgttgtgcctgaactgtttcatgtttttgaaattc |
300 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
50649054 |
tttttgattggagctatatatataatgtatatgtttattacctgaggattcgatatgtagacatatgttgtgcctgaactgtttcatgtttttgaaatcc |
50648955 |
T |
 |
Q |
301 |
ccttaacttatatttccatgctacaatttgttttatatgtgtcaat |
346 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
50648954 |
ccttaacttatatttccatgctacagtttgttttatatgtgtcaat |
50648909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 44 - 184
Target Start/End: Complemental strand, 50659693 - 50659553
Alignment:
Q |
44 |
tttctttgtagatgtcaactcttacaatcagttatgccaactagcaaatggtgaattcagaagtctgtttctttagggagcttgaagattgttggattag |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||| ||| | || |
|
|
T |
50659693 |
tttctttgtagatgtcaactcttacaatcagttatgccaactagcaaatggtgaatgcaaaagtctgtttctttagggatcttgaagattgctgggtcag |
50659594 |
T |
 |
Q |
144 |
ctagtggatggtattgagttgcagcctttatgctaaagaac |
184 |
Q |
|
|
| | |||||| |||| |||||| || |||||||||||| |
|
|
T |
50659593 |
caactggatgatattaggttgcaatgttcatgctaaagaac |
50659553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5717 times since January 2019
Visitors: 5758