View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_96 (Length: 367)
Name: NF0809_low_96
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 34 - 338
Target Start/End: Original strand, 33185559 - 33185863
Alignment:
Q |
34 |
agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagaggatt |
133 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
33185559 |
agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagaggatt |
33185658 |
T |
 |
Q |
134 |
tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca |
233 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33185659 |
tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca |
33185758 |
T |
 |
Q |
234 |
gcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatggaaaa |
333 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33185759 |
gcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatggaaaa |
33185858 |
T |
 |
Q |
334 |
aattg |
338 |
Q |
|
|
||||| |
|
|
T |
33185859 |
aattg |
33185863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University