View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_96 (Length: 367)

Name: NF0809_low_96
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_96
NF0809_low_96
[»] chr5 (1 HSPs)
chr5 (34-338)||(33185559-33185863)


Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 34 - 338
Target Start/End: Original strand, 33185559 - 33185863
Alignment:
34 agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagaggatt 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
33185559 agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagaggatt 33185658  T
134 tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33185659 tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca 33185758  T
234 gcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatggaaaa 333  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33185759 gcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatggaaaa 33185858  T
334 aattg 338  Q
    |||||    
33185859 aattg 33185863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5592 times since January 2019
Visitors: 5758