View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_high_19 (Length: 405)
Name: NF0810_high_19
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 40692660 - 40693039
Alignment:
| Q |
1 |
ctctgcaactgagttatgctcacggagacttcatcaatcatatttaacctcttgttttatttaaaaataatacatacatgcatacttcttggttcacagt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40692660 |
ctctgcaactgagttatgttcacggagatttcatcaaccatatttaacctcttgttttatttaaaaataatacatacatgcatatttcttggttcacagt |
40692759 |
T |
|
| Q |
101 |
atcatatatatcattttcaaattttgatttcattnnnnnnnnn----ctctttgtagtgtcattatagagagcttgcttgtgtagctactgccatacttg |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692760 |
atcatatatatctttttcaaattttgatctcattaaaaaaaaaaaacctctttgtagtgtcattatagagagcttgcttgtgtagctactgccatacttg |
40692859 |
T |
|
| Q |
197 |
cagttgaaaaatgctttctgttgaagcactctttgcttttagattatacatacctatagtatttattttatagtacacagaagtttaggttatacgcaga |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692860 |
cagttgaaaaatgctttctgttgaagcactctttgcttttagattatacatacctatagtttttattttatagtacacagaagtttaggttatacgcaga |
40692959 |
T |
|
| Q |
297 |
gtatacgcaaatacaccatacttgaatataccttgcctctaccccaccctttggtacccacctcttttatccgtttcttc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692960 |
gtatacgcaaatacaccatacttgaatataccttgcctctaccccaccctttggtacccacctcttttatccgtttcttc |
40693039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 56 times since January 2019
Visitors: 5829