View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_high_31 (Length: 267)
Name: NF0810_high_31
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 46 - 243
Target Start/End: Original strand, 50651811 - 50652008
Alignment:
Q |
46 |
gcaacgtctcttgtcccgcaccaccaaggacacagatcaggaacgtgcaggcccttatcttgtaaacgcacacggataggaacacagtcacgcaccacac |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
50651811 |
gcaacgtctcttgtcccgcaccaccaaggacacagatcaggaacgtgcgggcccttatcttgtaaacgcacacgaataggaacacagtcacgcaccacac |
50651910 |
T |
 |
Q |
146 |
gacacataaaagagtgaaattttggaggcgcagccagtttccacagcaacttccaataacctggcaccttatacgcagccgtatccaccatattcttc |
243 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |
|
|
T |
50651911 |
gacacataaaagagtgaaattttggaggcacagccagtttccacagcaacttccaataacctggcaccttatacgcagtcgtatccatcattttcttc |
50652008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University