View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_high_32 (Length: 266)
Name: NF0810_high_32
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 48648738 - 48648972
Alignment:
| Q |
1 |
gttcttaatttgttttctcttgagaatgagaatcaaacttgtagttcgagtgttggattaannnnnnnnnnnnnnnnngacttattagtagttgagttcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
48648738 |
gttcttaatttgttttctcttgagaatgagaatcaaacttgtagttcgagtgttggattaatttttctttctctttttgacttattagtagttcagttcg |
48648837 |
T |
|
| Q |
101 |
ggcatgcatgctctctgtcccttttttattttattcttccgtaccgatcgatataatacggtgcatctgcatatcaaacatcataaagtttcctcttagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48648838 |
ggcatgcatgctctctgtcccttttttattttattcttccgtaccgatcgatataatacggtgcatctgc--atcaaacatcataaagtttcctcttagt |
48648935 |
T |
|
| Q |
201 |
gggccaattaactgctgggtgatttgtaatggccaat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48648936 |
gggccaattaactgctgggtgatttgtaatggccaat |
48648972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1061 times since January 2019
Visitors: 5824