View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_high_33 (Length: 264)
Name: NF0810_high_33
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 45457660 - 45457405
Alignment:
Q |
1 |
tatggtgaactagatcagtagcatatacccctacactacactacattatattacacgtatgaatatgatgatatcaatatcaacacatatgttatgatat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45457660 |
tatggtgaactagatcagtagcatatacccctacactacactacattatattacacgtatgaatatgatgatatcaatatcaacacatatgttatgatat |
45457561 |
T |
 |
Q |
101 |
tgactcacagtcaatcacaaacaacatgtgcattcattcagacatacatagtgatcttcacgttaatgtgaatcaattatattgtatctccttgatctgt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
45457560 |
tgactcacagtcaatcacaaacaacatgtgcattcattcagacatacatagtgatcttcacgttaatgtgaatcaattatattgtatcaccttgatctgt |
45457461 |
T |
 |
Q |
201 |
cactgtggacggacagcttattattatta---ttataattcatcccctcatttcat |
253 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
45457460 |
cactgtggacggacagcttattattattattattataattcatcccctcatttcat |
45457405 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University