View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_high_36 (Length: 251)
Name: NF0810_high_36
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_high_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 40692190 - 40692427
Alignment:
| Q |
14 |
gaagagtgaaattggatcaattttttagtagaaattgtttggtggaaaatgaattgaatcaaacggagtaagatcaagtgaacttggttcagtagttatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40692190 |
gaagagtgaaattggatcaattttttagtagaaattgtttggtggaaaatgaattgaatcaaacggagtaagatcaactgaacttggttcagtagttatt |
40692289 |
T |
 |
| Q |
114 |
ttcattagaggtaaatggatcagttcctagcattgagaaaatagatcactgacttttttcttttaaaattgaagtatataaatttctgtgacagatttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692290 |
ttcattagaggtaaatggatcagttcctagcattcagaaaatagatcactgacttttttcttttaaaattgaagtatataaatttctgtgacagatttaa |
40692389 |
T |
 |
| Q |
214 |
ttggtgtcatgtggtccacttgattcatgaagaatact |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40692390 |
ttggtgtcatgtggtccacttgattcatgaagaatact |
40692427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University