View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_high_42 (Length: 217)

Name: NF0810_high_42
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_high_42
NF0810_high_42
[»] chr8 (1 HSPs)
chr8 (22-83)||(43864423-43864484)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 22 - 83
Target Start/End: Original strand, 43864423 - 43864484
Alignment:
22 aattcactcttggccgttgctggtttcttgcaatctaaatataacccttacaatattgttgg 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
43864423 aattcactcttggccgttgctggtttcttgcaatctaaatataacccttacaatatttttgg 43864484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 320 times since January 2019
Visitors: 5835