View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_19 (Length: 411)

Name: NF0810_low_19
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_19
NF0810_low_19
[»] chr7 (1 HSPs)
chr7 (96-312)||(48865274-48865502)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 96 - 312
Target Start/End: Original strand, 48865274 - 48865502
Alignment:
96 acgaagctgaatcaataaaaagtaaaccctaattatatgaaatgattgagaagaagaagattagggttaagagagagataccaaagccagcgatgagaca 195  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48865274 acgaagctgaatcaataaacagtaaaccctaattatatgaaatgattgagaagaagaagattagggttaagagagagataccaaagccagcgatgagaca 48865373  T
196 agaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagccat------------tttcaatttcaatttcgatttcgattca 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||    
48865374 agaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagccattttcaatttcaatttcaatttcaatttcgatttcgattca 48865473  T
284 ctctcttcttctcctttcttctgttctgt 312  Q
    |||  ||||||||||||||||||||||||    
48865474 ctcctttcttctcctttcttctgttctgt 48865502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1097 times since January 2019
Visitors: 5825