View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_19 (Length: 411)
Name: NF0810_low_19
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 1e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 96 - 312
Target Start/End: Original strand, 48865274 - 48865502
Alignment:
| Q |
96 |
acgaagctgaatcaataaaaagtaaaccctaattatatgaaatgattgagaagaagaagattagggttaagagagagataccaaagccagcgatgagaca |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48865274 |
acgaagctgaatcaataaacagtaaaccctaattatatgaaatgattgagaagaagaagattagggttaagagagagataccaaagccagcgatgagaca |
48865373 |
T |
|
| Q |
196 |
agaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagccat------------tttcaatttcaatttcgatttcgattca |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48865374 |
agaagcagcgacaactggttcttgagcaacgaacattctgagcctctccatcacagccattttcaatttcaatttcaatttcaatttcgatttcgattca |
48865473 |
T |
|
| Q |
284 |
ctctcttcttctcctttcttctgttctgt |
312 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
48865474 |
ctcctttcttctcctttcttctgttctgt |
48865502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1097 times since January 2019
Visitors: 5825