View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_23 (Length: 387)
Name: NF0810_low_23
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 28 - 165
Target Start/End: Original strand, 23664708 - 23664845
Alignment:
| Q |
28 |
catatgattctcagattctgcttacacgataaagcatatggttatacagaactaaagatgtgatgactttaactttaaaggtaatgtttcttggaatatg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23664708 |
catatgattctcagattctgcttacacgataaagcatatggttatacagaactaaagatgtgatgactttaactttagaggtaatgtttcttggaatatg |
23664807 |
T |
|
| Q |
128 |
tttgtaaattatgtatatatcttgcagcctctttatac |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23664808 |
tttgtaaattatgtatatatcttgcagcctctttatac |
23664845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 224 - 357
Target Start/End: Original strand, 23664904 - 23665037
Alignment:
| Q |
224 |
gttgtaagatttgtgatacgaatgtttgtcatgcatctggaattaataatggaaatcttgatgtgtaattgtatgcacaagttgggtatataattcaagg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23664904 |
gttgtaagatttgtgatacgaatgtttgtcatgcatctggaattaataatggaaatcttgatgtgtaattgtatgcacaagttgggtatataattcaagg |
23665003 |
T |
|
| Q |
324 |
tacagatttaagattctgatttctgacacactag |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23665004 |
tacagatttaagattctgatttctgacacactag |
23665037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 998 times since January 2019
Visitors: 5822