View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_30 (Length: 327)
Name: NF0810_low_30
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 86 - 279
Target Start/End: Original strand, 35259850 - 35260043
Alignment:
Q |
86 |
atactcaaggcgctttcgcgattttatatttagaattttcactgaagagacttttgaaacctagaacatgattttgctattcctcaagtttatgttatca |
185 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35259850 |
atactcgaggcgctttcgcgattttatatttagaattttcactgaagagacttttgaaacctagaacatgattttgctattcctcaagtttatgttatca |
35259949 |
T |
 |
Q |
186 |
tacttcatactttcannnnnnnnnnngtatagtacattatatatatgaacacattgtgaggaaactctgaaagcaggaggtactatatgtatat |
279 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35259950 |
tacttcatactttcatttttttttttgtatagtacattatatatatgaacacattgtgaggaaactctgaaagcaggaggtactatatgtatat |
35260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University