View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_31 (Length: 318)
Name: NF0810_low_31
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 30039816 - 30039589
Alignment:
| Q |
4 |
tttcttcacttcatagcttgcaagtcgcttttaactgtcttgtcatcattaattaattttgcttgcttagtgaccaatagaaaagaaatcttgcaacttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30039816 |
tttcttcacttcatagcttgcaagtcgcttttaactgtcttgtcatcattaattaattttgcttgcttagtgaccaatagaaaagaaatcttgcaacttg |
30039717 |
T |
 |
| Q |
104 |
ttcatcgttcctttccattgatgttgctaagtcatgtgtaaattatacccaataataaatgatagggtagcatttatatatttattgcatgcacatttaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30039716 |
ttcatcgttcctttccattgatgttgctaagtcatgtgtaaattatacccaataataaatgatagggtagcatttatatacctattgcatgcacatttaa |
30039617 |
T |
 |
| Q |
204 |
tagagaaatgataggtgtacacgggatc |
231 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
30039616 |
tagagaaatgataggtgtacatgggatc |
30039589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University