View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_33 (Length: 294)
Name: NF0810_low_33
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 30 - 282
Target Start/End: Complemental strand, 9659589 - 9659337
Alignment:
| Q |
30 |
atattcctattcatacaaagaagattcaaacaccccattagtgataaatgttctagcttcattaattgagaggaacatggcaagagcacaaagaattgtg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9659589 |
atattcctattcatacaaagaagattcaaacaccccattagtgataaatgttctagcttcattaattgagaggaacatggcaagagcacaaagaatagtg |
9659490 |
T |
 |
| Q |
130 |
aagaattgttcttctagagttttgtccaaagcaagcacaaaaatatttgattgtagagagattcctgatttaaccattcaatcttatttagagagaattt |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659489 |
aagaattgttcttcaagagttttgtccaaagcaagcacaaaaatctttgattgtagagagattcctgatttaaccattcaatcttatttagagagaattt |
9659390 |
T |
 |
| Q |
230 |
ttagatacacacgtgctggaccttcggtttatgttgttgcttatgtctatatt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659389 |
ttagatacacacgtgctggaccttcggtttatgttgttgcttatgtctatatt |
9659337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University