View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_34 (Length: 287)

Name: NF0810_low_34
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_34
NF0810_low_34
[»] chr5 (1 HSPs)
chr5 (1-189)||(41230666-41230854)


Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 41230854 - 41230666
Alignment:
1 agagtagatttaatcaaccgattactactagaagaaattttaaaacatcagaaagaaggnnnnnnnnnnngaataaaagggaattttagcaatttccttc 100  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||           ||||||||||||||||||||||||||||||    
41230854 agagtagactcaatcaaccgattactactagaagaaattttaaaacattagaaagaaggaaaaaaaaaaagaataaaagggaattttagcaatttccttc 41230755  T
101 ttgaagttgctgggatgaaagcttacaagagaaaatatcaaattgtggagaatagtcaaacttgcatgtgcaagtattgatgcattttt 189  Q
    ||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||    
41230754 ttgaagttgctgggatgaaagcttacaagagaaaatatccaatagtggagaatactcaaacttgcatgtgcaagtattgatgcattttt 41230666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University