View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_34 (Length: 287)
Name: NF0810_low_34
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 41230854 - 41230666
Alignment:
Q |
1 |
agagtagatttaatcaaccgattactactagaagaaattttaaaacatcagaaagaaggnnnnnnnnnnngaataaaagggaattttagcaatttccttc |
100 |
Q |
|
|
|||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
41230854 |
agagtagactcaatcaaccgattactactagaagaaattttaaaacattagaaagaaggaaaaaaaaaaagaataaaagggaattttagcaatttccttc |
41230755 |
T |
 |
Q |
101 |
ttgaagttgctgggatgaaagcttacaagagaaaatatcaaattgtggagaatagtcaaacttgcatgtgcaagtattgatgcattttt |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
41230754 |
ttgaagttgctgggatgaaagcttacaagagaaaatatccaatagtggagaatactcaaacttgcatgtgcaagtattgatgcattttt |
41230666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1148 times since January 2019
Visitors: 5827