View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_35 (Length: 280)
Name: NF0810_low_35
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 29 - 273
Target Start/End: Complemental strand, 25309111 - 25308866
Alignment:
| Q |
29 |
ttgagttcctttattagaaaaaatagatttatgaataacttttcattttgagaatnnnnnnncattttttctttcaaatctgaaacaaataatataaaga |
128 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25309111 |
ttgagttcctttattagaaaatatagatttatgaataacttttcattttgagaataaaaaa-cattttttctttcaaatctgaaacaaataatataaaga |
25309013 |
T |
|
| Q |
129 |
tnnnnnnnnntatatcttttagtcgaaaaatagannnnnnnnnnnn---gtaaatcccaaacaaacggcccttaattttttatctcgtattttgtctaat |
225 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
25309012 |
taaaaaaaaa-atatcttttagtcgaaaaatagatttttttttttttttgtaaatcccaaacaaaccgcccttgattttttatctcgtattttgtctaat |
25308914 |
T |
|
| Q |
226 |
tcatgactttagtttcttcatttctatattcattcataatctctgctc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25308913 |
tcatgactttagtttcttcatttctatattcattcataatctttgctc |
25308866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 212 times since January 2019
Visitors: 5833