View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_36 (Length: 269)
Name: NF0810_low_36
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_36 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 125 - 269
Target Start/End: Complemental strand, 45457849 - 45457705
Alignment:
Q |
125 |
taggatgaatgaatgaatacaaacaagtatttggaagaataagcgattaagacaatgcttgtgcttgttcaaattctatggacggacggagcatactaag |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45457849 |
taggatgaatgaatgaatacaaacaagtatttggaagaataagcgattaagacaatgcttgtgcttgttcaaattctatggacggacggagcatactaag |
45457750 |
T |
 |
Q |
225 |
tactgtaattaataagaagagaagaaaagatgatctgatcacaca |
269 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45457749 |
tactgtaattaataagaagagaagaaaagatgatctgatcacaca |
45457705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 45457958 - 45457886
Alignment:
Q |
30 |
atgagcagcaggatgcagttgagaagccatgtgatatgattagcagaacagaacagaacagaacaggaagggt |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45457958 |
atgagcagcaggatgcagttgagaagccatgtgatatgattagcagaacagaacagaacagaacaggaagggt |
45457886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 117 times since January 2019
Visitors: 5831