View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_37 (Length: 267)
Name: NF0810_low_37
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 40360331 - 40360521
Alignment:
Q |
1 |
tttttgttttccttgctgcaacactttgaacaacactgtcagcactacgtgatttttggtgcatgacaacaatgtttgaactcttacattcttcttcttc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40360331 |
tttttgttttccttgctgcaacactttgaacaacactgtcagcactacgtgatttttggtgcatgacaacaatgtttgaactcttacattcttcttcttc |
40360430 |
T |
 |
Q |
101 |
ctcttccttccttgtatcagcttcggtgcaataaattctgaaactcggagatccttggtataaaaatcttccgacttcgtcgtcgtcgtcg |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
T |
40360431 |
ctcttccttccttgtatcagcttcggtgcaataaattctgaaactcggagatccttggtataaaaatcttccaacttcatcgtcgtcgtcg |
40360521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 935 times since January 2019
Visitors: 5820