View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_47 (Length: 240)
Name: NF0810_low_47
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 48865502 - 48865274
Alignment:
| Q |
7 |
acagaacagaagaaaggagaagaagagagtgaatcgaaatcgaaattgaaattgaaa------------atggctgtgatggagaggctcagaatgttcg |
94 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48865502 |
acagaacagaagaaaggagaagaaaggagtgaatcgaaatcgaaattgaaattgaaattgaaattgaaaatggctgtgatggagaggctcagaatgttcg |
48865403 |
T |
|
| Q |
95 |
ttgctcaagaaccagttgtcgctgcttcttgtctcatcgctggctttggtatctctctcttaaccctaatcttcttcttctcaatcatttcatataatta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48865402 |
ttgctcaagaaccagttgtcgctgcttcttgtctcatcgctggctttggtatctctctcttaaccctaatcttcttcttctcaatcatttcatataatta |
48865303 |
T |
|
| Q |
195 |
gggtttactttttattgattcagcttcgt |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
48865302 |
gggtttactgtttattgattcagcttcgt |
48865274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 308 times since January 2019
Visitors: 5834