View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_48 (Length: 236)

Name: NF0810_low_48
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_48
NF0810_low_48
[»] chr4 (1 HSPs)
chr4 (1-218)||(35409875-35410092)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 35409875 - 35410092
Alignment:
1 caggtagcagttttatgatcagggtgacccaagatgatgaatgcattgtaccaggactggaggacattgtaagaagaaacggtatttaaatctttgtagt 100  Q
    ||||||||| |||||||||||||||| |||| | |||||||| | |||||||||||||||||  |||||| |||||||| || ||| |||||||||||||    
35409875 caggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaagaaatggcattcaaatctttgtagt 35409974  T
101 aatggttcacacaggtcctgaccaacttctctatactagtccatatggggagtccatcagccgcataaggataatcttcagtaagtagtctaatgccatg 200  Q
    ||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
35409975 aatggttcacataggtcctgaccaacttctctatactagaccatatgaggagtccatcagccgcataaggataatcttcaataagtagtctaatgccatg 35410074  T
201 tggctgagtggcatctgg 218  Q
    |||| |||||||||||||    
35410075 tggccgagtggcatctgg 35410092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University