View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_48 (Length: 236)
Name: NF0810_low_48
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 35409875 - 35410092
Alignment:
Q |
1 |
caggtagcagttttatgatcagggtgacccaagatgatgaatgcattgtaccaggactggaggacattgtaagaagaaacggtatttaaatctttgtagt |
100 |
Q |
|
|
||||||||| |||||||||||||||| |||| | |||||||| | ||||||||||||||||| |||||| |||||||| || ||| ||||||||||||| |
|
|
T |
35409875 |
caggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaagaaatggcattcaaatctttgtagt |
35409974 |
T |
 |
Q |
101 |
aatggttcacacaggtcctgaccaacttctctatactagtccatatggggagtccatcagccgcataaggataatcttcagtaagtagtctaatgccatg |
200 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
35409975 |
aatggttcacataggtcctgaccaacttctctatactagaccatatgaggagtccatcagccgcataaggataatcttcaataagtagtctaatgccatg |
35410074 |
T |
 |
Q |
201 |
tggctgagtggcatctgg |
218 |
Q |
|
|
|||| ||||||||||||| |
|
|
T |
35410075 |
tggccgagtggcatctgg |
35410092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University