View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_49 (Length: 230)
Name: NF0810_low_49
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_49 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 34 - 230
Target Start/End: Complemental strand, 33572053 - 33571857
Alignment:
| Q |
34 |
atcaagttcataattttggtttgaactttcattcttaaatcaacttgttaattattgatttcaggtttaattggggatgtagattgcaaaacctatcaaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33572053 |
atcaagttcataattttggtttgaactttcattcttaaatcaacttgttaattattgatttcaggtttaattggggatgtagaatgcaaaacctatcaaa |
33571954 |
T |
|
| Q |
134 |
cgaaatactaagacttttacaaggtggagaaggtctaaaagaggcacgtttgaaagcactaaaaataacaactgaaatacaaggttttggaggttca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33571953 |
cgaaatactaagacttttacaaggtggagaaggtctaaaagaggcacgtttgaaagcactaaaaataacaactgaaatacaaggttttggaggttca |
33571857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 5834