View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_49 (Length: 230)

Name: NF0810_low_49
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_49
NF0810_low_49
[»] chr1 (1 HSPs)
chr1 (34-230)||(33571857-33572053)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 34 - 230
Target Start/End: Complemental strand, 33572053 - 33571857
Alignment:
34 atcaagttcataattttggtttgaactttcattcttaaatcaacttgttaattattgatttcaggtttaattggggatgtagattgcaaaacctatcaaa 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
33572053 atcaagttcataattttggtttgaactttcattcttaaatcaacttgttaattattgatttcaggtttaattggggatgtagaatgcaaaacctatcaaa 33571954  T
134 cgaaatactaagacttttacaaggtggagaaggtctaaaagaggcacgtttgaaagcactaaaaataacaactgaaatacaaggttttggaggttca 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33571953 cgaaatactaagacttttacaaggtggagaaggtctaaaagaggcacgtttgaaagcactaaaaataacaactgaaatacaaggttttggaggttca 33571857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University