View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_52 (Length: 222)

Name: NF0810_low_52
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_52
NF0810_low_52
[»] chr1 (4 HSPs)
chr1 (1-192)||(36524827-36525018)
chr1 (1-190)||(36531162-36531351)
chr1 (9-189)||(26305989-26306169)
chr1 (1-77)||(20716220-20716296)
[»] chr7 (1 HSPs)
chr7 (51-184)||(47090535-47090668)
[»] chr2 (1 HSPs)
chr2 (87-145)||(6791477-6791535)
[»] chr4 (1 HSPs)
chr4 (83-145)||(49156796-49156858)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 36524827 - 36525018
Alignment:
1 tggactggtatggaattcttcaggcagaaagtctctccgaggaagccatcataaggaaacagtacagaaagcttgcactgctacttcatcctgataaaaa 100  Q
    ||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||| || | | |||||||||||| |||||||||    
36524827 tggactggtatggaattcttcagacagaaagtctctccgaggaagcaatcataaagaaacagtacagaaaactcggattgctacttcatcttgataaaaa 36524926  T
101 taaatttgctggtgcagaagctgcgttcaagttgattggggaagccaatagcgttttgactgaccaagcaaagcgatcattatacgacatga 192  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||| |||||||    
36524927 taaatttactggtgcagaagctgcgttcaagttgattggggaagccaatagcgtgttgactgaccaagcaaagtgatctttataggacatga 36525018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 36531162 - 36531351
Alignment:
1 tggactggtatggaattcttcaggcagaaagtctctccgaggaagccatcataaggaaacagtacagaaagcttgcactgctacttcatcctgataaaaa 100  Q
    |||||||||||||| |||||||| | ||||   | ||||||||||| ||||||| |||||||||||  ||||||||||||||||||||||||||||||||    
36531162 tggactggtatggagttcttcagactgaaaaattatccgaggaagcaatcataaagaaacagtacaagaagcttgcactgctacttcatcctgataaaaa 36531261  T
101 taaatttgctggtgcagaagctgcgttcaagttgattggggaagccaatagcgttttgactgaccaagcaaagcgatcattatacgacat 190  Q
    ||||| |||||||||||||||||| |||||||||||||||||||||||||| || |||| |||  |||||| ||| || |||||||||||    
36531262 taaatctgctggtgcagaagctgctttcaagttgattggggaagccaatagggtgttgagtgataaagcaacgcggtctttatacgacat 36531351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 9 - 189
Target Start/End: Complemental strand, 26306169 - 26305989
Alignment:
9 tatggaattcttcaggcagaaagtctctccgaggaagccatcataaggaaacagtacagaaagcttgcactgctacttcatcctgataaaaataaatttg 108  Q
    |||| |||||||||| || | ||  ||||||||||||| ||||||| ||  |||||||||||||| |||||||||||||||||||||||||||||||||     
26306169 tatgaaattcttcagacacatagattctccgaggaagcaatcataaagacgcagtacagaaagctcgcactgctacttcatcctgataaaaataaatttt 26306070  T
109 ctggtgcagaagctgcgttcaagttgattggggaagccaatagcgttttgactgaccaagcaaagcgatcattatacgaca 189  Q
    ||||||| |||||||| |||||||||||||| ||||||||||| ||||||| |||||||||| | ||||| ||||| ||||    
26306069 ctggtgctgaagctgctttcaagttgattggagaagccaatagggttttgagtgaccaagcacaacgatctttatatgaca 26305989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 20716296 - 20716220
Alignment:
1 tggactggtatggaattcttcaggcagaaagtctctccgaggaagccatcataaggaaacagtacagaaagcttgca 77  Q
    |||||||||||| |||||||||| ||||||| |||||||||||| | |||| || |||||||||||||||| |||||    
20716296 tggactggtatgaaattcttcagacagaaagactctccgaggaaacaatcacaaagaaacagtacagaaagattgca 20716220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 51 - 184
Target Start/End: Complemental strand, 47090668 - 47090535
Alignment:
51 ataaggaaacagtacagaaagcttgcactgctacttcatcctgataaaaataaatttgctggtgcagaagctgcgttcaagttgattggggaagccaata 150  Q
    |||| ||| ||||| | |||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||| ||||||||||| | ||| || || |    
47090668 ataaagaagcagtataaaaagcttgcactgctacttcatcctgataaaaataaatctgctggggcagaggctgctttcaagttgatcgtggatgctaaca 47090569  T
151 gcgttttgactgaccaagcaaagcgatcattata 184  Q
    | || |||| ||||||| ||||||| || |||||    
47090568 gagtattgagtgaccaaacaaagcgttctttata 47090535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 87 - 145
Target Start/End: Original strand, 6791477 - 6791535
Alignment:
87 catcctgataaaaataaatttgctggtgcagaagctgcgttcaagttgattggggaagc 145  Q
    |||||||| ||||| || |||||||||||||||||||| || ||| |||||||||||||    
6791477 catcctgacaaaaacaagtttgctggtgcagaagctgcatttaagctgattggggaagc 6791535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 145
Target Start/End: Complemental strand, 49156858 - 49156796
Alignment:
83 acttcatcctgataaaaataaatttgctggtgcagaagctgcgttcaagttgattggggaagc 145  Q
    |||||||||||||||||| || ||||| ||||| |||||||| || ||| ||||||| |||||    
49156858 acttcatcctgataaaaacaagtttgccggtgctgaagctgcatttaagctgattggagaagc 49156796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 95 times since January 2019
Visitors: 5830