View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_54 (Length: 218)
Name: NF0810_low_54
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0810_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 41230830 - 41231036
Alignment:
Q |
1 |
gtaatcggttgattaaatctactctaagctgctgcatctccttaaaaatctaccttgaagggagggatgcaagaaagttatcaagcgtatgaattttgca |
100 |
Q |
|
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41230830 |
gtaatcggttgattgagtctactctaagctgctgcatctccttaaaaatctaccttgaagggagggatgcaagaaagttatcaagcgtatgaattttgca |
41230929 |
T |
 |
Q |
101 |
ggaaggagctccttctggaagctttacgggttttatgttcagttttctgttagatcagcttcactcgaccgaccattctccaaattggtcgcttttcctc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41230930 |
ggaaggagctccttctggaagctttacgggttttatgttcagttttctgttagatcagcttcactcgaccgaccattctccaaattggtcgcttttcctc |
41231029 |
T |
 |
Q |
201 |
tgtctct |
207 |
Q |
|
|
||||||| |
|
|
T |
41231030 |
tgtctct |
41231036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 164
Target Start/End: Original strand, 6110308 - 6110339
Alignment:
Q |
133 |
ttatgttcagttttctgttagatcagcttcac |
164 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
6110308 |
ttatgttcagttttctgttagatcagcttcac |
6110339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University