View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_58 (Length: 208)

Name: NF0810_low_58
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_58
NF0810_low_58
[»] chr7 (2 HSPs)
chr7 (111-185)||(41574802-41574876)
chr7 (1-38)||(41574949-41574986)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 111 - 185
Target Start/End: Complemental strand, 41574876 - 41574802
Alignment:
111 attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatatac 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41574876 attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatatac 41574802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 41574986 - 41574949
Alignment:
1 acaacccttattataatcaattccggtacatacaggtt 38  Q
    ||||||||||||||||||||||| ||||||||||||||    
41574986 acaacccttattataatcaattctggtacatacaggtt 41574949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University