View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_58 (Length: 208)
Name: NF0810_low_58
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 111 - 185
Target Start/End: Complemental strand, 41574876 - 41574802
Alignment:
| Q |
111 |
attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatatac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574876 |
attcaatagaattccatcaatatttaacaaaaaacacataactaactactaactagtgttttcaattgtatatac |
41574802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 41574986 - 41574949
Alignment:
| Q |
1 |
acaacccttattataatcaattccggtacatacaggtt |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41574986 |
acaacccttattataatcaattctggtacatacaggtt |
41574949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University