View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0810_low_60 (Length: 202)

Name: NF0810_low_60
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0810_low_60
NF0810_low_60
[»] chr8 (1 HSPs)
chr8 (1-124)||(44856303-44856426)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 44856426 - 44856303
Alignment:
1 tttagagttgataaaggagtcaactttgattctgtttacatggaagatatgggtggggacaagtcttcaaggttggtaccaaacatggttaggattatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44856426 tttagagttgataaaggagtcaactttgattctgtttacatggaagatatgggtggggacaagtcttcaaggttggtaccaaacatggttaggattatgg 44856327  T
101 ttgcacctggtttttatgcctatg 124  Q
    |||||||||||||||||| |||||    
44856326 ttgcacctggtttttatgtctatg 44856303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1126 times since January 2019
Visitors: 5826