View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0810_low_61 (Length: 201)
Name: NF0810_low_61
Description: NF0810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0810_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 35746170 - 35746332
Alignment:
| Q |
18 |
atgaaattttaggttggtaatagaaaaatttgagacatatgcatgcatgaatatgcatgcatttagggggctagtcctaacgttgatgcaaaaaccaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35746170 |
atgaaattttaggttggtaatagaaaaatttgagacatatgcatgcatgaatatgcatgcatttagggggctagtcctaacgttgatgcaaaaaccaaat |
35746269 |
T |
|
| Q |
118 |
taatgatatgatgagaattgtaatggaactttctcaaaagagagagccaaggaataaaaatga |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35746270 |
taatgatatgatgagaattgtaatggaactttctcaaaagagagagccaaggaattaaaatga |
35746332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 982 times since January 2019
Visitors: 5822