View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811-Insertion-4 (Length: 146)
Name: NF0811-Insertion-4
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811-Insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 8e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 11849013 - 11849120
Alignment:
| Q |
18 |
tcaaagttagcaaggtaatgacccttgtcaaggtggttggttggggattgtttgttctagtgggaacatttcagttatcgccttcgagaaaatgggtttt |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11849013 |
tcaaagttggcaaggtaatgacccttgtcaaggtggttggttagggattgtttgttctagtgggaacatttcagttatcgccttcgagaaaatgggtttt |
11849112 |
T |
 |
| Q |
118 |
tccggtag |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
11849113 |
tccggtag |
11849120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 9e-25
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 11858134 - 11858065
Alignment:
| Q |
18 |
tcaaagttagcaaggtaatgacccttgtcaaggtggttggttggggattgtttgttctagtgggaacatt |
87 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
11858134 |
tcaaagttggcaaggtaatgacccttgtcaaggtggttggttgggggttgtttgttctagtggcaacatt |
11858065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University