View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811-Insertion-5 (Length: 78)
Name: NF0811-Insertion-5
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0811-Insertion-5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 29; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 36
Target Start/End: Complemental strand, 41024185 - 41024157
Alignment:
Q |
8 |
gagattagaaaatcaacactactataacc |
36 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
41024185 |
gagattagaaaatcaacactactataacc |
41024157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University