View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_18 (Length: 322)
Name: NF0811_high_18
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 2919225 - 2918940
Alignment:
| Q |
1 |
acttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtccagtgttaaagaggacatattgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2919225 |
acttatattctattttctagctagcataattaactggaactttgttatagagcattgaagggttgcctttgatgtccagtgttaaagaggacatatggta |
2919126 |
T |
 |
| Q |
101 |
ttttgtggannnnnnnnnnnnnnnnncaatgtgttacttcttctgaattattttgctagataatttgattgtttatacaagatttaaacttcaatagatt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2919125 |
ttttgtggatttttttttt-------caatgtgttacttcttctgaattattttgctagataatttgattgtttatacaagatttaaacttcaatagatt |
2919033 |
T |
 |
| Q |
201 |
tcttttaggctttgctgcataaggttaagcatattcttattaatttagaattctttgtatgcgtttttgttatccattcatagctgccactat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2919032 |
tcttttaggctttgctgcataaggttaagcatattcttattaatttagaattctttgtatgcgtttttgttatccattcatagctgccactat |
2918940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University