View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_19 (Length: 311)
Name: NF0811_high_19
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0811_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 34 - 282
Target Start/End: Original strand, 36402681 - 36402929
Alignment:
Q |
34 |
cacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaat |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36402681 |
cacttacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaat |
36402780 |
T |
 |
Q |
134 |
cttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccaccgacacatgttcttcactaccaccttgacca |
233 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36402781 |
cttagcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccctatccaccgacacatgttcttcactaccaccttgacca |
36402880 |
T |
 |
Q |
234 |
cttgcacgtgcacttccaccagccatatttcttctgctagtaggagatg |
282 |
Q |
|
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
T |
36402881 |
cttgcacgtgaacttccactagccatatttcttctgctagtaggagatg |
36402929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 38 - 196
Target Start/End: Original strand, 21428795 - 21428953
Alignment:
Q |
38 |
tacctcaacttttttcatccatgaagtagctttctgaacctgttcactctcccagccattgatgacagcatcatctctcttgaacctgttattaatctta |
137 |
Q |
|
|
|||||||||||| ||||||||||| |||||||||||||||| ||| ||||||| |||||||| |||||||| || || || ||||||||||||| |||| |
|
|
T |
21428795 |
tacctcaactttcatcatccatgaattagctttctgaacctgctcattctcccaaccattgataacagcatcttcccttttaaacctgttattaacctta |
21428894 |
T |
 |
Q |
138 |
gcaactttagcattctgccaagctgatatctttgcatcaacttcctccttcttcaccct |
196 |
Q |
|
|
||||| ||||| || ||||| || | |||||| | ||||| || || ||||||||||| |
|
|
T |
21428895 |
gcaaccttagcgttttgccatgcagctatcttggactcaacctcttctttcttcaccct |
21428953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5801 times since January 2019
Visitors: 5759