View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_20 (Length: 297)
Name: NF0811_high_20
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 29 - 288
Target Start/End: Original strand, 18592571 - 18592830
Alignment:
| Q |
29 |
aataaaatggaagaagaaaatggtattatttggtacctcttttttgagataaacctttgcttgaaggcaaccactttcttcaacgattaaaacgatgccg |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18592571 |
aataaaattgaagaagaaaatggtattatttggtacctcttttttgagataaacctttgcttgaaggcaaccactttcttcaacgattaaaacgatgccg |
18592670 |
T |
|
| Q |
129 |
tgttcggataattctatgacggcgtcttggtggcgcttccatcgtacggcggttagagcgtcgactaagccttgtacgttttccagttcgcatagaacgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18592671 |
tgttcggataattctatgacggcgtcttggtggcgcttccatcgaacggcggttaaagcgtcgactaagccttgtacgttttccagttcgcatagaacgt |
18592770 |
T |
|
| Q |
229 |
ctggtaattcttcatccatttctgacattgtcgggatgaaaccctctgttcgttctctgc |
288 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18592771 |
ctggtgcttcttcatccatttctgacattgtcgagatgaaaccctctgttcgttctctgc |
18592830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6292 times since January 2019
Visitors: 5767