View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_38 (Length: 241)
Name: NF0811_high_38
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_high_38 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 140 - 241
Target Start/End: Original strand, 36408550 - 36408651
Alignment:
| Q |
140 |
ttcattccagtatgttttctatacttcccgtgnnnnnnnaacttatatctgtttctcattctatcataagaaacaaacttatctgtttttcaataatatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
36408550 |
ttcattccagtatgttttctatacttcctgtgtttgtttaacttatatctgtttctcattctatcagaagaaaaaaacttatctgtttttcaataatatc |
36408649 |
T |
 |
| Q |
240 |
aa |
241 |
Q |
| |
|
|| |
|
|
| T |
36408650 |
aa |
36408651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 6 - 53
Target Start/End: Original strand, 36408416 - 36408463
Alignment:
| Q |
6 |
atacaagatcagaccgagtcgaagcttgtcggtgaaagaagcactgaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36408416 |
atacaagatcagaccgagtcgaagcttggcggtgaaagaagcactgaa |
36408463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University