View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_4 (Length: 581)
Name: NF0811_high_4
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 285 - 552
Target Start/End: Complemental strand, 13585083 - 13584828
Alignment:
| Q |
285 |
gcaccaccaaaggtaggaataacatcatagaacaaataaaggacatgtggaaaaatagagaacatcaaactcatcattgtcatatcagttctcttatata |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13585083 |
gcaccaccaaaggtaggaataacatcatagaataaataaaggacatgtggaaaaatggagaacatcaaactcatcattgtcataccagttctcttatata |
13584984 |
T |
|
| Q |
385 |
tccaaatttgcagaaaaacaagaagaattaatctaacataaacacttttcaacaaccaaaacattgttgggcctatggattcacccagagattgcggcaa |
484 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13584983 |
tccaaatttgcagaaaaacaagaagaattaatctaacataaacacttttcaacaaccaaaacattgttgggcctatggattcacccagagattgcggcaa |
13584884 |
T |
|
| Q |
485 |
ctcaaaaacgacgtcggaaaggagcttctgcggctgtggaaggagcttgttccgatcagagaactttg |
552 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
13584883 |
ctcaaaaac------------aagcttttgcggccgtggaaggagcttgttccgatcacagaactttg |
13584828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 52 - 221
Target Start/End: Complemental strand, 13585312 - 13585147
Alignment:
| Q |
52 |
tgtgtcggcatgtcagtgtccatatctgtgtctggtgtcagtgcttcttagatnnnnnnnnncaaaggcattaaaccaaagggaacaagaaacaaactct |
151 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13585312 |
tgtgtcggcatgtcagtgtcaatatc-gtgtctggtgtccgtgcttcttagataaaaaa---caaaggcattaaaccaaagggaacaagaaacaaactct |
13585217 |
T |
|
| Q |
152 |
tactgcgcaagaaagctcttcccttaactgatcaatacaaggaacatcaataccgttttgagtcaacttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13585216 |
tactgcgcaagaaagctcttcccttaactgatcaatacaaggaacatcaatgccgttttgagtcaacttg |
13585147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4951 times since January 2019
Visitors: 5753