View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_high_44 (Length: 203)
Name: NF0811_high_44
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 32135389 - 32135315
Alignment:
| Q |
21 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatgata |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32135389 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgttgagcctatgata |
32135315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 22025529 - 22025458
Alignment:
| Q |
21 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatg |
92 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
22025529 |
gattcccggatagcattttcagacttgtgtcatttaaatactccttctttagtatttattactgaacctatg |
22025458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 18740070 - 18740006
Alignment:
| Q |
21 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctga |
85 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
18740070 |
gattcccggatagaatttagagatatgtgtcatttaaatactccatctttagtatttattgctga |
18740006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 18741307 - 18741243
Alignment:
| Q |
21 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctga |
85 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
18741307 |
gattcccgaatagcatttagagatatgtgtcatttaaatactccatctttagtatttattgctga |
18741243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 21 - 92
Target Start/End: Original strand, 20850662 - 20850733
Alignment:
| Q |
21 |
gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatg |
92 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
20850662 |
gattcccggatagcattttcagacttgtgtcatttaaatactccttctttagtatttattgctgaacctatg |
20850733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University