View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0811_high_44 (Length: 203)

Name: NF0811_high_44
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0811_high_44
NF0811_high_44
[»] chr2 (2 HSPs)
chr2 (21-95)||(32135315-32135389)
chr2 (21-92)||(22025458-22025529)
[»] chr6 (2 HSPs)
chr6 (21-85)||(18740006-18740070)
chr6 (21-85)||(18741243-18741307)
[»] chr5 (1 HSPs)
chr5 (21-92)||(20850662-20850733)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 32135389 - 32135315
Alignment:
21 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatgata 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
32135389 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgttgagcctatgata 32135315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 22025529 - 22025458
Alignment:
21 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatg 92  Q
    |||||||||||||| ||   |||  ||||||||||||||||||||||||| ||||||||| |||| ||||||    
22025529 gattcccggatagcattttcagacttgtgtcatttaaatactccttctttagtatttattactgaacctatg 22025458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 18740070 - 18740006
Alignment:
21 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctga 85  Q
    |||||||||||||  || |||||||||||||||||||||||||| ||||| ||||||||||||||    
18740070 gattcccggatagaatttagagatatgtgtcatttaaatactccatctttagtatttattgctga 18740006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 18741307 - 18741243
Alignment:
21 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctga 85  Q
    |||||||| ||||| || |||||||||||||||||||||||||| ||||| ||||||||||||||    
18741307 gattcccgaatagcatttagagatatgtgtcatttaaatactccatctttagtatttattgctga 18741243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 21 - 92
Target Start/End: Original strand, 20850662 - 20850733
Alignment:
21 gattcccggatagctttcagagatatgtgtcatttaaatactccttctttggtatttattgctgagcctatg 92  Q
    |||||||||||||| ||   |||  ||||||||||||||||||||||||| |||||||||||||| ||||||    
20850662 gattcccggatagcattttcagacttgtgtcatttaaatactccttctttagtatttattgctgaacctatg 20850733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6541 times since January 2019
Visitors: 5768