View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_14 (Length: 451)
Name: NF0811_low_14
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 97 - 305
Target Start/End: Original strand, 43241240 - 43241448
Alignment:
| Q |
97 |
cattcaggggagaatttgaaacgcttatttctcctaaggatgtgcttctatactgggaatacattcattgctgcagcatttccttttatgggtgactttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43241240 |
cattcaggggagaatttgaaacgcttatttctcctaaggatgtgcttctatactgggaatacattcattgctgcagcatttccttttatgggtgactttg |
43241339 |
T |
|
| Q |
197 |
taaacttgctaggctcattttcactagttcctcttaccttcatgttcccaagcatgatcttccttaaggtactatctccgtccataaatataagataagt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43241340 |
taaacttgctaggctcattttcactagttcctcttaccttcatgttcccaagcatgatctttcttaaggtactatctccgtccataaatataagataagt |
43241439 |
T |
|
| Q |
297 |
ctctggaac |
305 |
Q |
| |
|
||||||||| |
|
|
| T |
43241440 |
ctctggaac |
43241448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 341 - 440
Target Start/End: Original strand, 43241481 - 43241580
Alignment:
| Q |
341 |
acgactaatttgtttatacttctgttttaatcgaagataaagggaaaaacggctagaacagagaagaaggtgtggcattggatcaacattgtcgtttcat |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43241481 |
acgactaatttgtttatacttttgttttaatcaaagataaagggaaaaactgctagaacagagaagaaggtgtggcattggatcaacattgtcgtttcat |
43241580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5658 times since January 2019
Visitors: 5758