View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_27 (Length: 304)
Name: NF0811_low_27
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 67 - 228
Target Start/End: Complemental strand, 2549234 - 2549074
Alignment:
| Q |
67 |
ggttagataataaggataaggatacacataggatgtattgtgtcttggtccattgaatgaggagttttaaacaaatgcatcactatataactttagtttc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549234 |
ggttagataataaggataaggatacacataggatgtattgtgtcttggtcccttgaatgaggagttttaaacaaatgcatcactatataactttagtttc |
2549135 |
T |
|
| Q |
167 |
ttatgtatcttttagaatgacgtgttttgagccagtaatactggtttgtatcttgtgttatg |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2549134 |
ttatgtatcttttagaatgacatgttttgag-cagtaatactggtttgtatcttgtgttatg |
2549074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5313 times since January 2019
Visitors: 5755