View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_30 (Length: 285)
Name: NF0811_low_30
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 5 - 260
Target Start/End: Original strand, 36408405 - 36408660
Alignment:
| Q |
5 |
gagcagcacagatacaagatcagaccgagtcgaagcttggcggtgaaagaagcactgaaatgtaaattgatattttcactctgtgcctttttaagtttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36408405 |
gagcagcacagatacaagatcagaccgagtcgaagcttggcggtgaaagaagcactgaaatgtaaattgatattttcacactgtgcctttttaagtttgt |
36408504 |
T |
|
| Q |
105 |
ttaaagtataaggttgcaaatttctaagggaattctgtgaagtgattcattccagtatgttttctatacttcccgtgtttgtttaacttatatctgtttc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36408505 |
ttaaagtataaggttgcaaatttctaagggaattctgtgaagtgattcattccagtatgttttctatacttcctgtgtttgtttaacttatatctgtttc |
36408604 |
T |
|
| Q |
205 |
tcattctatcagaagnnnnnnncttatctgtttttcaataatatcaatattatgat |
260 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36408605 |
tcattctatcagaagaaaaaaacttatctgtttttcaataatatcaatattatgat |
36408660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6321 times since January 2019
Visitors: 5767