View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_32 (Length: 278)
Name: NF0811_low_32
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0811_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 263
Target Start/End: Original strand, 36408409 - 36408660
Alignment:
Q |
12 |
agcacagatacaagatcagaccgagtcgaagcttggcggtgaaagaagcactgaaatgtaaattgatattttcactctgtgcctttttaagtttgtttaa |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
36408409 |
agcacagatacaagatcagaccgagtcgaagcttggcggtgaaagaagcactgaaatgtaaattgatattttcacactgtgcctttttaagtttgtttaa |
36408508 |
T |
 |
Q |
112 |
agtataaggttgcaaatttctaagggaattctgtgaagtgattcattccagtatgttttctatacttcccgtgtttgtttaacttatatctgtttctcat |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
36408509 |
agtataaggttgcaaatttctaagggaattctgtgaagtgattcattccagtatgttttctatacttcctgtgtttgtttaacttatatctgtttctcat |
36408608 |
T |
 |
Q |
212 |
tctatcagaagnnnnnnncttatctgtttttcaataatatcaatattatgat |
263 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
36408609 |
tctatcagaagaaaaaaacttatctgtttttcaataatatcaatattatgat |
36408660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4829 times since January 2019
Visitors: 5752