View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_38 (Length: 251)
Name: NF0811_low_38
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 40844937 - 40845177
Alignment:
| Q |
1 |
atcatagtctaacataaaatttgtagtttagaaccatagatagt-atgtaatgtcgtctttgaattttaaaattaaatataagtactactaactaactat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40844937 |
atcatagtctaacataaaatttgtagtttagaaccatagatagttatgtaatgtcgtctttgaattttaaaattaaatataagtactactaactaacgat |
40845036 |
T |
|
| Q |
100 |
gaatcaagtttaaccacttaatttctcgttatnnnnnnngtttaaccacttaattcaagtgattaatcaaattaataaggtactgaacaaatcaagttac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40845037 |
gaatcaagtttaaccacttaatttctcgttataaaaaaagtttaaccacttaattcaagtgattaatc-aattaataaggtactgaacaaatcaagttac |
40845135 |
T |
|
| Q |
200 |
ctgcaagaagtcatacaaatcgttgctaatactgtcttcatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40845136 |
ctgcaagaagtcatacaaatcgttgctaatactgtcttcatc |
40845177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 241
Target Start/End: Original strand, 40851165 - 40851221
Alignment:
| Q |
185 |
aacaaatcaagttacctgcaagaagtcatacaaatcgttgctaatactgtcttcatc |
241 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| | ||| ||||||| || ||||||||| |
|
|
| T |
40851165 |
aacagatcaagttacctgcaagaaatcatatagatcattgctaacaccgtcttcatc |
40851221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6431 times since January 2019
Visitors: 5768