View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_40 (Length: 251)
Name: NF0811_low_40
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0811_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 33223044 - 33223176
Alignment:
| Q |
1 |
aatagataggttatttgatggcctaagctatgagataatagatgtagttcatttacaatactttatcgatattgagaagcttgttcataagaaattcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223044 |
aatagataggttatttgatggcctaagctatgagataatagatgtagttcatttacaatactttatcgatattgagaagcttgttcataagaaattcatt |
33223143 |
T |
 |
| Q |
101 |
gttgagcaacaattgaagagaaagatcatttat |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33223144 |
gttgagcaacaattgaagagaaagatcatttat |
33223176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 143 - 244
Target Start/End: Original strand, 33223206 - 33223307
Alignment:
| Q |
143 |
ggcatcaaccaacgattcttcacattgaaaggacaagcataaaagggaggacaannnnnnncctaaagtcttcacttctaaatacaagaacgattcatct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
33223206 |
ggcatcaaccaacgattcttcacattgaaaggacaagcataaaagggaggacaatttttttcctaaagtcttgacttctaaatacaagaatgattcatct |
33223305 |
T |
 |
| Q |
243 |
ca |
244 |
Q |
| |
|
|| |
|
|
| T |
33223306 |
ca |
33223307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University