View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0811_low_47 (Length: 244)
Name: NF0811_low_47
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0811_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 24 - 179
Target Start/End: Complemental strand, 10121762 - 10121607
Alignment:
Q |
24 |
tgggaaaggaagtgaagcggtttctgctgaaaacagaaccgtctgagtggtcatgggaggatcaagaagcaaacggagggataagtaaatgggatggcgt |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
10121762 |
tgggaaaggaagtgaagcggtttctgctgaaaacagaaccgtctgagtggtcatgggaggatcaagaagcaaatggagggataagtaaatgggatggcgt |
10121663 |
T |
 |
Q |
124 |
taaaaacaaacaagctcatagatatctcaaatccatgtcactcaatgttctctgct |
179 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10121662 |
taaaaacaaacaagctcatagatatctcaaatccatgtcactcaatgttctctgct |
10121607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 24 - 179
Target Start/End: Complemental strand, 376285 - 376130
Alignment:
Q |
24 |
tgggaaaggaagtgaagcggtttctgctgaaaacagaaccgtctgagtggtcatgggaggatcaagaagcaaacggagggataagtaaatgggatggcgt |
123 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
T |
376285 |
tgggaaaggaagtgaagaggtttctgctgaaaacagaaccgtctgagtggtcatgggaggaccaagaagcaaacggagggataagcaaatgggatggcgt |
376186 |
T |
 |
Q |
124 |
taaaaacaaacaagctcatagatatctcaaatccatgtcactcaatgttctctgct |
179 |
Q |
|
|
|||||||||||||||||| | |||||||||||||||||||||||| | |||||||| |
|
|
T |
376185 |
taaaaacaaacaagctcagaaatatctcaaatccatgtcactcaacgatctctgct |
376130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University