View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0811_low_52 (Length: 218)

Name: NF0811_low_52
Description: NF0811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0811_low_52
NF0811_low_52
[»] chr4 (1 HSPs)
chr4 (1-75)||(21725211-21725285)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 21725285 - 21725211
Alignment:
1 tgtgcttattttggtttgttgtagtcgaattatgttgagtaatcaaagtagttgtcccaccgtagtggaaactaa 75  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21725285 tgtgcttattttggtttgttgtagtcgaattatgttgagtaatcaaagtagttgtcccaccgtagtggaaactaa 21725211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5907 times since January 2019
Visitors: 5761