View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_100 (Length: 295)
Name: NF0812_high_100
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_100 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 37 - 285
Target Start/End: Original strand, 43606437 - 43606693
Alignment:
| Q |
37 |
atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaacctctaataattgctaattgaatcagaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||| ||||| |
|
|
| T |
43606437 |
atggttgataaaactatgtattatttcactcgaaatagtttatgtagttttattggttcaagtcaatttaaa-ctttaacaattgctaattgaaacagaa |
43606535 |
T |
|
| Q |
137 |
cgagcccctaacttcctctaatattgta---------ccatccttcctacattcacccatgtgcttaaatgtttcaaatctcttctcacttgaaccagtt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43606536 |
cgagcccctaacttcctctaatattgtattcttatagccatccttcctacattcacccatgtgtttaaatgtttcaaatctcttgtcacttgaaccagtt |
43606635 |
T |
|
| Q |
228 |
cattaaaaaactattattgaatgaaaacaattattttcttaacttaaatgcacctttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||| |
|
|
| T |
43606636 |
cattaaaaaactattattgaatgaaaacaactattttcttagcttaaatgcacttttg |
43606693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5606 times since January 2019
Visitors: 5758