View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_106 (Length: 285)
Name: NF0812_high_106
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 4570004 - 4570247
Alignment:
| Q |
7 |
gtagcatagggttgtattgaggttgcggtcggtgtcgaggtgggagagagggagggtgtggtcttcaaggaagggggtgtgagaaggaaaaatgagaatt |
106 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4570004 |
gtagcgtatggttgtattgaggttgcggtcgatgtcgaggtgggagagagggagggtgtggtcttcaaggaagggggtgtgagaaggaaaaatgagagtt |
4570103 |
T |
|
| Q |
107 |
tgttctttaattttcaacattttaaatttaattgtatggtttgtgttatgttgtgaggttatttttgcttaatgctacctgattgctttgctttgtctgt |
206 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570104 |
tgttctttgattttcaacatttta------attgtatggtttgtgttatgttgtgaggttatttttgcttaatgctacctgattgctttgctttgtctgt |
4570197 |
T |
|
| Q |
207 |
gttttcagcgttggagatttgagtcactttctcccaccaaacccatagag |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570198 |
gttttcagcgttggagatttgagtcactttctcccaccaaacccatagag |
4570247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5411 times since January 2019
Visitors: 5757