View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_107 (Length: 275)
Name: NF0812_high_107
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 46618669 - 46618810
Alignment:
| Q |
1 |
catggtgcatccaatgattcctttaggtaagagtctctgtaggtagcataatgttcatgtctgttgtgataatgttctgatcttttccttggtgacaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618669 |
catggtgcatccaatgattcctttaggtaagagtctctgtaggtagcataatgttcatgtctgttgtgataatgttctgatcttttccttggtgacaatc |
46618768 |
T |
|
| Q |
101 |
caacaccaggtagcctaccagccattcactcttctttaccta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618769 |
caacaccaggtagcctaccagccattcactcttctttaccta |
46618810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6542 times since January 2019
Visitors: 5768