View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0812_high_127 (Length: 251)
Name: NF0812_high_127
Description: NF0812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0812_high_127 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 74 - 251
Target Start/End: Complemental strand, 45519507 - 45519331
Alignment:
| Q |
74 |
tgcctactttcttgttcttgaattagtaggcaattttaaacaaatccattttgcaaattccagctaacatctaactgcttcaaggtcaaacttgaatgca |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45519507 |
tgcctactttcttgttcttgaattagtaggcaattttaaacaaatccattttgcaaattccagctaacatctaactgcttcaaggtcaaacttgaatgca |
45519408 |
T |
|
| Q |
174 |
attattcaattgactctatgctagctccttttnnnnnnnnnttctattaacctgatctttccatggaagaaactttat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45519407 |
attattcaattgactctatgctagctcctttt-aaaaaaaattctattaacttgatctttccatggaagaaactttat |
45519331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6862 times since January 2019
Visitors: 5772